Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • 2021-03
  • br GTCTCAAACATGATCTGGG br Inhibition of CD expression

    2020-08-30


    GTCTCAAACATGATCTGGG’3.
    2.5. Inhibition of CD73 expression
    To inhibit CD73 expression in the CeCa cell lines, the following CD73-specific siRNAs were used (NM_001204813.1 and NM_002526.3): siRNA-1, GAT CCG CCA CTA GCA TCT CAA ATA TTT CAA GAG AAT ATT TGA GAT GCT AGT GGT TTT TTA CGC GTG; and siRNA-2, AAT TCA CGC GTA AAA AAC CAC TAG CAT CTC AAA TAT TCT CTT GAA ATA TTT GAG ATG CTA GTG GCG (RNAi Target Sequence Selector, http://www.clontech.com/MX/Support/Online_Tools). The pSIREN-Retro Q vector (Clontech Laboratories, Inc. Mountain View, CA, USA) was used to perform the transfection. Selection of stably transfected ZD 1839 was performed in the presence of puromycin (Sigma-Aldrich) ac-cording to the manufacturer’s manual (KnockoutTM siRNA Systems, Clontech Laboratories, Inc.). Because the pSIREN-Retro Q vector con-tains a puromycin-resistant gene, the empty pSIREN- Retro Q vector was used as a control.
    CD73 expression on the membrane of tumor cells was determined using an anti-CD73-PE monoclonal antibody (BD Biosciences, San  Cytokine 118 (2019) 71–79
    Diego, CA, USA) and a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA). After discarding cell debris, 10,000 events were analyzed and reported as the mean fluorescence intensity (MFI) ± SD. Additionally, CD73 mRNA expression was analyzed by RT-PCR using the methodology described above. The following primers were used: CD73 Forward, 5′GCACTATCTGGTTCACCGTGT’3; and CD73 Reverse, 5′CCTTCCACACCATTATCAAATTC’3).
    To analyze CD73 hydrolytic activity in CeCa tumor cells and CD73-dysregulated cells, 1 × 106 cells were cultured in the presence of 5 mM AMP in 100 μl of Opti-MEM (Gibco) supplemented with 1% dialyzed FBS. Supernatant was collected after 4 h for CaSki cells and after 8 h for HeLa cells. The presence of Ado was detected by thin layer chromato-graphy (TLC) by placing 1 μl of each supernatant on fluorescent gel-coated plates (Whatman, GE Healthcare, Freiburg, Germany). Samples were eluted for 1 h using a mobile phase composed of iso-butanol:isoamyl alcohol:ethoxyethanol:ammonia:water (9:6:18:9:15) [37], and 5 mM AMP, Ado and Inosine (Ino) (Sigma-Aldrich) were used as standard controls. Compounds were visualized using an UV tran-silluminator.
    2.8. Functional activity of TGF-β1
    TGF-β1-sensitive Mv1Lu cells [38] were used to evaluate the func-tional activity of TGF-β1 produced by CeCa cells. Mv1Lu cells (5 × 103 cells) were cultured in triplicate in a 96-well flat bottom plate in the presence of 50% conditioned media from CeCa cells cultured with 1 mM Ado and in the presence or absence of anti-TGF-β neutralizing antibody. Mv1Lu cells cultured in the presence of rh-TGF-β1 (0, 12.5, 25, 50 and 100 ng/ml) or Ado (0 μM, 31.25 μM, 62.5 μM, 125 μM, 250 μM 500 μM, 1 mM and 10 mM) were used as positive and negative controls, re-spectively. The proliferation of Mv1Lu cells was determined with the CellTiter 96 AQueous One Solution reagent (Promega, Madison, WI, USA) in accordance with the manufacturer’s instructions.
    2.9. Statistical analysis
    The numerical data are presented as the average value ± SEM of three independent experiments. The comparisons were evaluated with multivariate statistical analysis using GraphPad Prism version 6 (GraphPad Prismsoftware, USA). The differences were considered sig-nificant when p < 0.05.
    3. Results
    3.1. Ado induces the expression and secretion of TGF-β1 in CeCa cells through interaction with A2AR and A2BR
    CeCa tumor cells hydrolyze AMP and generate large amounts of Ado from the enzymatic activity of CD73 [29]. In addition, recent studies have shown that Ado induces the production of TGF-β1 in different cell types through the interaction of A2AR and A2BR [34–36]. To determine if Ado generated through the functional activity of CD73 induces the expression and secretion of TGF-β1 in CeCa cells, 1 × 105 CaSki and HeLa tumor cells were cultured for 96 h in 6-well plates in the presence of different concentrations (1 μM, 10 μM, 100 μM and 1 mM) of AMP. Aliquots of the supernatants were collected every 24 h to determine TGF-β1content by ELISA. At the end of culture, cells were harvested and analyzed for TGF-β1 mRNA expression. CaSki cells significantly increased TGF-β1 production at 24 h in the presence of 1 mM AMP (Fig. 1A). HeLa cells increased TGF-β1 production at 72 h in the
    R. García-Rocha et al.
    Fig. 4. Ado induces TGF-β production in CeCa cells through interaction with A2AR and A2BR. CaSki and HeLa cells (1 × 105) were cultured for 96 h in the presence of 1 mM AMP (A and D) or Ado
    presence of AMP at concentrations ≥ 10 μM (Fig. 1C). Similar results were obtained when culturing CaSki (Fig. 1B) and HeLa (Fig. 1D) cells in the presence of the same concentrations of synthetic Ado. To cor-roborate the participation of the CD73-Ado pathway in TGF-β1 pro-duction in CeCa cells, the expression of CD73 in CaSki and HeLa cells was inhibited with siRNAs targeting CD73 isoforms (NM_001204813.1 and NM_002526.3) using the pSiren vector (pS/siRNA-CD73). The